# Paired-seq

Check [this GitHub page](https://teichlab.github.io/scg_lib_structs/methods_html/Paired-seq.html) to see how __Paired-seq__ libraries are generated experimentally. This is a split-pool based combinatorial indexing method, where open chromatin DNA are transposed by indexed homo-dimer Tn5 and mRNA molecules are reverse transcribed by barcoded oligo-dT primers. Then three rounds of ligation are performed to added three 7-bp barcodes. UMI is added at the last round of ligation. After that, the reaction was split into two portion, one for ATAC and the other for RNA library preparations. Single cells can be identified by the combination of the Tn5/RT barcode plus three 7-bp barcodes.

## For Your Own Experiments

If you follow the protocol from the paper, you should have two libraries per sample: one for RNA and the other for ATAC. The libraries consists of standard Illumina adapters (Nextera + TruSeq), so you could sequence them via your core facility or a company or by yourself. If you sequence your data via your core facility or a company, you will need to provide the sample and modality index sequence. In this case, it is basically `i7` + `i5`. They will demultiplex for you and give you back two `fastq` files per sample per modality.

Your sequencing read configuration is like this:

| Order | Read             | Cycle   | Description                                                             |
|-------|------------------|---------|-------------------------------------------------------------------------|
| 1     | Read 1           | >50     | This yields `R1_001.fastq.gz`, genomic insert and cDNA reads            |
| 2     | Index 1 (__i7__) | 8 or 10 | This yields `I1_001.fastq.gz`, Sample and modality index                |
| 3     | Index 2 (__i5__) | 8 or 10 | This yields `I2_001.fastq.gz`, Sample and modality index                |
| 4     | Read 2           | 130     | This yields `R2_001.fastq.gz`, UMI + cell barcodes and linker sequences |

The 4th read (__Read 2__) has the following information, which will be used to identify single cells (__NOTE:__ `LB` means __Ligation Barcode__, see later section about whitelist, then you will understand):

| Modality | Length | Sequence (5' -> 3')                                                                                                                                                                         |
|----------|--------|---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
| ATAC     | 130 bp | 10 bp __UMI__ + 7 bp `LB` + 0-3 Ns + GTGGCCGATGTTTCGCATCGGCGTACGACT + 7 bp `LB` GGATTCGAGGAGCGTGTGCGAACTCAGACC + 7 bp `LB` + ATCCACGTGCTTGAGAGGCCAGAGCATTCGTC + 3 bp Tn5 barcode + the rest |
| RNA      | 130 bp | 10 bp __UMI__ + 7 bp `LB` + 0-3 Ns + GTGGCCGATGTTTCGCATCGGCGTACGACT + 7 bp `LB` GGATTCGAGGAGCGTGTGCGAACTCAGACC + 7 bp `LB` + ATCCACGTGCTTGAGAGGCCAGAGCATTCGAG + 3 bp RT barcode + the rest  |

The 0 - 3 random bases (`N`) in the middle is there to increase the base complexities.

If you sequence by yourself, you need to run `bcl2fastq` by yourself with a `SampleSheet.csv` and without the `--create-fastq-for-index-reads` flag, because they are not really needed after demultiplexing. Here is an example of `SampleSheet.csv` of a NextSeq run with two different samples using the standard indexing primers from the __Paired-seq__ paper (6-bp i7, 8-bp i5):

```text
[Header],,,,,,,,,,,
IEMFileVersion,5,,,,,,,,,,
Date,17/12/2019,,,,,,,,,,
Workflow,GenerateFASTQ,,,,,,,,,,
Application,NextSeq FASTQ Only,,,,,,,,,,
Instrument Type,NextSeq/MiniSeq,,,,,,,,,,
Assay,AmpliSeq Library PLUS for Illumina,,,,,,,,,,
Index Adapters,AmpliSeq CD Indexes (384),,,,,,,,,,
Chemistry,Amplicon,,,,,,,,,,
,,,,,,,,,,,
[Reads],,,,,,,,,,,
53,,,,,,,,,,,
130,,,,,,,,,,,
,,,,,,,,,,,
[Settings],,,,,,,,,,,
,,,,,,,,,,,
[Data],,,,,,,,,,,
Sample_ID,Sample_Name,Sample_Plate,Sample_Well,Index_Plate,Index_Plate_Well,I7_Index_ID,index,I5_Index_ID,index2,Sample_Project,Description
Sample01_ATAC,,,,,,P701,ATCACG,N502,ATAGAGAG,,
Sample01_RNA,,,,,,P702,CGATGT,N503,AGAGGATA,,
Sample02_ATAC,,,,,,P703,TTAGGC,N504,TCTACTCT,,
Sample02_RNA,,,,,,P704,TGACCA,N505,CTCCTTAC,,
```

Simply run `bcl2fastq` like this:

```console
bcl2fastq --no-lane-splitting \
          --ignore-missing-positions \
          --ignore-missing-controls \
          --ignore-missing-filter \
          --ignore-missing-bcls \
          -r 4 -w 4 -p 4
```

After this, you will have `R1_001.fastq.gz` and `R2_001.fastq.gz` per sample per modality. Using the examples above, these are the files you should get:

```bash
# Sample 01 ATAC
Sample01_ATAC_S1_R1_001.fastq.gz # 50 bp: genomic insert
Sample01_ATAC_S1_R2_001.fastq.gz # 130 bp: UMI and Cell barcodes

# Sample 01 RNA
Sample01_RNA_S2_R1_001.fastq.gz # 50 bp: cDNA insert
Sample01_RNA_S2_R2_001.fastq.gz # 130 bp: UMI and Cell barcodes

# Sample 02 ATAC
Sample02_ATAC_S3_R1_001.fastq.gz # 50 bp: genomic insert
Sample02_ATAC_S3_R2_001.fastq.gz # 130 bp: UMI and Cell barcodes

# Sample 02 RNA
Sample02_RNA_S4_R1_001.fastq.gz # 50 bp: cDNA insert
Sample02_RNA_S4_R2_001.fastq.gz # 130 bp: UMI and Cell barcodes
```

You are ready to go from here.

## Public Data

We will use the data from the following paper:

```{eval-rst}
.. note::

  Zhu C, Yu M, Huang H, Juric I, Abnousi A, Hu R, Lucero J, Behrens MM, Hu M, Ren B (2019) **An ultra high-throughput method for single-cell joint analysis of open chromatin and transcriptome.** *Nat Struct Mol Biol* 26:1063–1070. https://doi.org/10.1038/s41594-019-0323-x

```

where the authors developed __Paired-seq__ for the first time and described the technical details of the method. The data is deposited to GEO under the accession code [GSE130399](https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE130399). There are quite a few samples, and we are going to use the __Adult Cerebral Cortex Lib#1__ sample (__SRR8980190__ for ATAC, and __SRR8980191__ for RNA). We could simply download the `fastq` files from [ENA](https://www.ebi.ac.uk/ena/browser/view/PRJNA539985?show=reads):

```bash
mkdir -p paired-seq/data
wget -P paired-seq/data -c \
    ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR898/000/SRR8980190/SRR8980190_1.fastq.gz \
    ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR898/000/SRR8980190/SRR8980190_2.fastq.gz \
    ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR898/001/SRR8980191/SRR8980191_1.fastq.gz \
    ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR898/001/SRR8980191/SRR8980191_2.fastq.gz
```

According to the __Paired-seq__ publication, Read 1 should be 53 bp and Read 2 should be 130 bp. However, if you look inside the downloaded files, you will see reads with variable lengths with a maximum 53 bp in Read 1 and 130 bp in Read 2. Not sure what happened, but let's remove the shorter reads. In this case, you need [Cutadapt](https://cutadapt.readthedocs.io/en/stable/) or the like. The commands are:

```bash
# Clean ATAC
cutadapt -j 4 -m 53:130 -o paired-seq/data/SRR8980190_cleaned_R1.fastq.gz -p paired-seq/data/SRR8980190_cleaned_R2.fastq.gz paired-seq/data/SRR8980190_1.fastq.gz paired-seq/data/SRR8980190_2.fastq.gz

# Clean RNA
cutadapt -j 4 -m 53:130 -o paired-seq/data/SRR8980191_cleaned_R1.fastq.gz -p paired-seq/data/SRR8980191_cleaned_R2.fastq.gz paired-seq/data/SRR8980191_1.fastq.gz paired-seq/data/SRR8980191_2.fastq.gz
```

The `-m v1[:v2]` option will remove Read 1 sequence with less than `v1` in length and Read 2 sequence with less than `v2` in length. Now the `cleaned_R1.fastq.gz` and `cleaned_R2.fastq.gz` is our starting point.

Now we are ready to process the RNA data. However, for ATAC data, we need some extra work, because the 0 - 3 random bases (`N`) in the middle of Read 2 make the situation more complicated. The random bases have different length: None, 1, 2 or 3. This makes the barcode position variable in different reads, and `chromap` currently does not support such complex barcodes. Therefore, we need to extract the cell barcodes with [UMI-tools](https://umi-tools.readthedocs.io/en/latest/index.html), because it supports regular expression. This step is kind of slow, especially for large data sets:

```bash
umi_tools extract --extract-method=regex \
                  --bc-pattern2='(?P<umi_1>.{10})(?P<cell_1>.{7}).{0,3}(?P<discard_1>GTGGCCGATGTTTCGCATCGGCGTACGACT){s<=3}(?P<cell_2>.{7})(?P<discard_2>GGATTCGAGGAGCGTGTGCGAACTCAGACC){s<=3}(?P<cell_3>.{7})(?P<discard_3>ATCCACGTGCTTGAGAGGCCAGAGCATTCGAG){s<=3}(?P<cell_4>.{3}).*' \
                  --stdin=paired-seq/data/SRR8980190_cleaned_R1.fastq.gz \
                  --stdout=paired-seq/data/SRR8980190_extracted_R1.fastq.gz \
                  --read2-in=paired-seq/data/SRR8980190_cleaned_R2.fastq.gz \
                  --read2-out=/dev/null
```

### Explain The Cell Barcode Extraction

You can check the [UMI-tools documentation](https://umi-tools.readthedocs.io/en/latest/Single_cell_tutorial.html#variations) to see exactly what the command means. Here I explain them briefly:

`--extract-method=regex`: Use regular expression for the pattern matching.

`--bc-pattern2`:

> Search the pattern in Read 2 using the specified regular expression. If you are familiar with regular expression, this should be relatively straightforward to understand. From 5' to 5', it consists of the following part:
> - `(?P<umi_1>.{10})`: Capture this 10 bp as UMI.
> - `(?P<cell_1>.{7})`: Capture this 7 bp as cell barcode 1.
> - `.{0,3}`: this is the 0 - 3 random Ns, we don't do anything.
> - `(?P<discard_1>GTGGCCGATGTTTCGCATCGGCGTACGACT){s<=3}`: We want to discard this linker sequence, with 3 mismatches allowed.
> - `(?P<cell_2>.{7})`: Capture this 7 bp as cell barcode 2.
> - `(?P<discard_2>GGATTCGAGGAGCGTGTGCGAACTCAGACC){s<=3}`: We want to discard this linker sequence, with 3 mismatches allowed.
> - `(?P<cell_3>.{7})`: Capture this 7 bp as cell barcode 3.
> - `(?P<discard_3>ATCCACGTGCTTGAGAGGCCAGAGCATTCGAG){s<=3}`: We want to discard this linker sequence, with 3 mismatches allowed.
> - `(?P<cell_4>.{3})`: Capture this 3 bp as cell barcode 3.
> - `.*`: There may or may not be some leftover sequence which we don't care.

`--stdin`: Read 1 file.

`--stdout`: Read 1 file with extracted cell barcode and UMI information in the header.

`--read2-in`: Read 2 file.

`--read2-out=/dev/null`: After getting the cell barcodes and UMI, the Read 2 file does not contain any useful information, so we don't output it.

Unfortunately, `UMI-tools` does not output cell barcodes and UMI as separate `fastq` files at this time of writing (2022-Aug-10). It only extracts the cell barcodes and UMI to the header of the other file, in this case, the header of `R1`, and we have lost the quality strings at this point. If you look at the first few lines of the output file `SRR8980190_extracted_R1.fastq.gz`:

```
@SRR8980190.5_ACCAAGTATAAGGGCCTAAGATCT_AAGCAGAGAC 5/1
AGCCAGAGCATGGAGGAAATGCCTGTCTGCGCCTTCAGATCCCCCTCGTGCGC
+
DDDDDIIIIIIIIIIIIIIIIIIIHIIIHIIIIIIIIIHIHIHIIIIIIIIII
@SRR8980190.6_GCTCGAACCTAGTCATGTGCCTGA_CCGAGTTAAC 6/1
CAGGNTATCCAGTGCAGGTGTTTGAGCAGGTGAATCAGATTGCCATAAGNGCG
+
DDDD#<DEHHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHH#<DG
@SRR8980190.7_CATCGATAGGAGGTACCCTTTATC_CTGTGGCTAT 7/1
CTCCACTGTGGCACTTTTTCTCCACCAGACCTCGTGTATATCTCTGTGCTGGG
+
DDDDDIIIHIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
```

We can see the cell barcodes at the header in the 2nd field using `_` as the separator. To get this information to a new `fastq` files, we can use `awk` and generate fake quality strings. In addition, we don't really need the UMI for ATAC-seq (maybe it is useful ...):

```bash
zcat paired-seq/data/SRR8980190_extracted_R1.fastq.gz | \
    awk -F '_' '(NR%4==1){print $0 "\n" $2 "\n+\n" "IIIIIIIIIIIIIIIIIIIIIIII"}' | \
    gzip > paired-seq/data/SRR8980190_extracted_CB.fastq.gz
```

After that, we are ready to begin the preprocessing.

## Prepare Whitelist

Cells are barcoded for the first time by either barcoded (3 bp) Tn5 for DNA or oligo-dT primers, followed by three more rounds of ligation. Each round will add 7-bp __Ligation Barcode__ to the molecules. There are 96 different __Ligation Barcodes__ in each round. The same set of 96 __Ligation Barcodes__ are used in each round. Single cells can be identified by the combination of themselves. Here is the information from the [Supplementary Table 2](https://teichlab.github.io/scg_lib_structs/data/Paired-seq/41594_2019_323_MOESM3_ESM.xlsx) from the [__Paired-seq__ paper](https://www.nature.com/articles/s41594-019-0323-x):

__Round 1 barcodes (eight 3-bp Tn5 or oligo-dT barcodes)__

| Name   | Sequence | Reverse complement |
|--------|----------|:------------------:|
| R01_01 | ATC      |         GAT        |
| R01_02 | TGA      |         TCA        |
| R01_03 | GCT      |         AGC        |
| R01_04 | CAG      |         CTG        |
| R01_05 | AGA      |         TCT        |
| R01_06 | TCT      |         AGA        |
| R01_07 | GAG      |         CTC        |
| R01_08 | CTC      |         GAG        |

__Round 2, 3 and 4 barcodes (7 bp)__

| Name         | Sequence | Reverse complement |
|--------------|----------|:------------------:|
| R02/03/04_01 | AAACCGG  |       CCGGTTT      |
| R02/03/04_02 | AAACGTC  |       GACGTTT      |
| R02/03/04_03 | AAAGATG  |       CATCTTT      |
| R02/03/04_04 | AAATCCA  |       TGGATTT      |
| R02/03/04_05 | AAATGAG  |       CTCATTT      |
| R02/03/04_06 | AACACTG  |       CAGTGTT      |
| R02/03/04_07 | AACGTTT  |       AAACGTT      |
| R02/03/04_08 | AAGAAGC  |       GCTTCTT      |
| R02/03/04_09 | AAGCCCT  |       AGGGCTT      |
| R02/03/04_10 | AAGCTAC  |       GTAGCTT      |
| R02/03/04_11 | AATCTTG  |       CAAGATT      |
| R02/03/04_12 | ACAACAC  |       GTGTTGT      |
| R02/03/04_13 | ACAGTAT  |       ATACTGT      |
| R02/03/04_14 | ACCAAGT  |       ACTTGGT      |
| R02/03/04_15 | ACCCTAA  |       TTAGGGT      |
| R02/03/04_16 | ACCCTTT  |       AAAGGGT      |
| R02/03/04_17 | ACCTCTC  |       GAGAGGT      |
| R02/03/04_18 | ACGATTG  |       CAATCGT      |
| R02/03/04_19 | ACGCAGA  |       TCTGCGT      |
| R02/03/04_20 | ACGTAAA  |       TTTACGT      |
| R02/03/04_21 | ACTACCT  |       AGGTAGT      |
| R02/03/04_22 | ACTCGGT  |       ACCGAGT      |
| R02/03/04_23 | ACTGTCG  |       CGACAGT      |
| R02/03/04_24 | ACTTATG  |       CATAAGT      |
| R02/03/04_25 | AGAAAGG  |       CCTTTCT      |
| R02/03/04_26 | AGAATCT  |       AGATTCT      |
| R02/03/04_27 | AGACATA  |       TATGTCT      |
| R02/03/04_28 | AGAGACC  |       GGTCTCT      |
| R02/03/04_29 | AGCCCAA  |       TTGGGCT      |
| R02/03/04_30 | AGCTATT  |       AATAGCT      |
| R02/03/04_31 | AGGAGGT  |       ACCTCCT      |
| R02/03/04_32 | AGGGCTT  |       AAGCCCT      |
| R02/03/04_33 | AGGTGTA  |       TACACCT      |
| R02/03/04_34 | AGTGCTC  |       GAGCACT      |
| R02/03/04_35 | AGTGGGA  |       TCCCACT      |
| R02/03/04_36 | AGTTACG  |       CGTAACT      |
| R02/03/04_37 | ATAAGGG  |       CCCTTAT      |
| R02/03/04_38 | ATCATTC  |       GAATGAT      |
| R02/03/04_39 | ATGGAAC  |       GTTCCAT      |
| R02/03/04_40 | ATGTGCC  |       GGCACAT      |
| R02/03/04_41 | ATTCACC  |       GGTGAAT      |
| R02/03/04_42 | ATTCGAG  |       CTCGAAT      |
| R02/03/04_43 | CAAGCCT  |       AGGCTTG      |
| R02/03/04_44 | CACAAGG  |       CCTTGTG      |
| R02/03/04_45 | CACCTTA  |       TAAGGTG      |
| R02/03/04_46 | CAGAGTG  |       CACTCTG      |
| R02/03/04_47 | CAGCGAA  |       TTCGCTG      |
| R02/03/04_48 | CAGGTCA  |       TGACCTG      |
| R02/03/04_49 | CATAACT  |       AGTTATG      |
| R02/03/04_50 | CATATCG  |       CGATATG      |
| R02/03/04_51 | CATCGAT  |       ATCGATG      |
| R02/03/04_52 | CATTACA  |       TGTAATG      |
| R02/03/04_53 | CATTTCC  |       GGAAATG      |
| R02/03/04_54 | CCAAATG  |       CATTTGG      |
| R02/03/04_55 | CCACTTG  |       CAAGTGG      |
| R02/03/04_56 | CCGGATA  |       TATCCGG      |
| R02/03/04_57 | CCGGTTT  |       AAACCGG      |
| R02/03/04_58 | CCTAAGA  |       TCTTAGG      |
| R02/03/04_59 | CCTAGTC  |       GACTAGG      |
| R02/03/04_60 | CCTGCAA  |       TTGCAGG      |
| R02/03/04_61 | CGACGTT  |       AACGTCG      |
| R02/03/04_62 | CGAGTAA  |       TTACTCG      |
| R02/03/04_63 | CGATTAT  |       ATAATCG      |
| R02/03/04_64 | CGTAGCA  |       TGCTACG      |
| R02/03/04_65 | CGTCTGA  |       TCAGACG      |
| R02/03/04_66 | CTACAGC  |       GCTGTAG      |
| R02/03/04_67 | CTCAATA  |       TATTGAG      |
| R02/03/04_68 | CTCGTTG  |       CAACGAG      |
| R02/03/04_69 | CTCTACG  |       CGTAGAG      |
| R02/03/04_70 | CTTGGGT  |       ACCCAAG      |
| R02/03/04_71 | GAAACTC  |       GAGTTTC      |
| R02/03/04_72 | GACTGTC  |       GACAGTC      |
| R02/03/04_73 | GATACAG  |       CTGTATC      |
| R02/03/04_74 | GCGATCA  |       TGATCGC      |
| R02/03/04_75 | GCGTACT  |       AGTACGC      |
| R02/03/04_76 | GCTCGAA  |       TTCGAGC      |
| R02/03/04_77 | GGAAGAA  |       TTCTTCC      |
| R02/03/04_78 | GGAGATT  |       AATCTCC      |
| R02/03/04_79 | GGGCTAA  |       TTAGCCC      |
| R02/03/04_80 | GGGTATG  |       CATACCC      |
| R02/03/04_81 | GGTAACC  |       GGTTACC      |
| R02/03/04_82 | GGTAGTG  |       CACTACC      |
| R02/03/04_83 | GGTGAAA  |       TTTCACC      |
| R02/03/04_84 | GTAATCG  |       CGATTAC      |
| R02/03/04_85 | GTATAAG  |       CTTATAC      |
| R02/03/04_86 | GTCAGAC  |       GTCTGAC      |
| R02/03/04_87 | GTCCCTT  |       AAGGGAC      |
| R02/03/04_88 | GTGCCAT  |       ATGGCAC      |
| R02/03/04_89 | GTGGTCT  |       AGACCAC      |
| R02/03/04_90 | GTTCTCC  |       GGAGAAC      |
| R02/03/04_91 | GTTGCTT  |       AAGCAAC      |
| R02/03/04_92 | TACCCGA  |       TCGGGTA      |
| R02/03/04_93 | TAGACGA  |       TCGTCTA      |
| R02/03/04_94 | TAGTCAC  |       GTGACTA      |
| R02/03/04_95 | TCACATC  |       GATGTGA      |
| R02/03/04_96 | TCAGCTG  |       CAGCTGA      |

I have prepared the above two tables as `csv` files for you, and you can download them:

[paired-seq_bc01.csv](https://teichlab.github.io/scg_lib_structs/data/Paired-seq/paired-seq_bc01.csv)  
[paired-seq_bc02-03-04.csv](https://teichlab.github.io/scg_lib_structs/data/Paired-seq/paired-seq_bc02-03-04.csv)

Since during each ligation round, the same set of __Ligation Barcodes__ (96) are used. Therefore, the whitelist is basically the combination of those 96 barcodes themselves for three times and with those 8 barcodes in the first round: a total of __96 * 96 * 96 * 8 = 7,077,888__ barcodes. Since the barcodes are sequenced as __Read 2__, which uses the top strand as the template, we should use the barcode sequences as they are to construct the whitelist. In addition, the order of the barcodes in __Read 2__ is Round 4 -> Round 3 -> Round 2 -> Round 1. Therefore, we need to generate the whitelist in this order. Again, if you are confused, check the [Paired-seq GitHub page](https://teichlab.github.io/scg_lib_structs/methods_html/Paired-seq.html).

```bash
# download the barcode files
wget -P paired-seq/data https://teichlab.github.io/scg_lib_structs/data/Paired-seq/paired-seq_bc01.csv \
    https://teichlab.github.io/scg_lib_structs/data/Paired-seq/paired-seq_bc02-03-04.csv

# generate whitelist for chromap
for w in $(tail -n +2 paired-seq/data/paired-seq_bc02-03-04.csv | cut -f 2 -d,); do
    for x in $(tail -n +2 paired-seq/data/paired-seq_bc02-03-04.csv | cut -f 2 -d,); do
        for y in $(tail -n +2 paired-seq/data/paired-seq_bc02-03-04.csv | cut -f 2 -d,); do
            for z in $(tail -n +2 paired-seq/data/paired-seq_bc01.csv | cut -f 2 -d,); do
                echo "${x}${y}${z}"
                done
            done
        done
    done > paired-seq/data/whitelist.txt

# get plain barcode sequence, one per line for starsolo

tail -n +2 paired-seq/data/paired-seq_bc01.csv | \
    cut -f 2 -d, > paired-seq/data/round1_bc.txt

tail -n +2 paired-seq/data/paired-seq_bc02-03-04.csv | \
    cut -f 2 -d, > paired-seq/data/round234_bc.txt
```

You will see in the later section why we need those additional files for `starsolo`. Now we are ready to start the preprocessing.

## From FastQ To Count Matrices

Let's map the reads to the genome using `starsolo` for the RNA library and `chromap` for the ATAC library:

```console
mkdir -p paired-seq/star_outs
mkdir -p paired-seq/chromap_outs

# process the RNA library using starsolo

STAR --runThreadN 4 \
     --genomeDir mm10/star_index \
     --readFilesCommand zcat \
     --outFileNamePrefix paired-seq/star_outs/ \
     --readFilesIn paired-seq/data/SRR8980191_cleaned_R1.fastq.gz paired-seq/data/SRR8980191_cleaned_R2.fastq.gz \
     --soloType CB_UMI_Complex \
     --soloAdapterSequence ATCCACGTGCTTGAGAGGCCAGAGCATTCGTC \
     --soloAdapterMismatchesNmax 3 \
     --soloCBposition 0_10_0_16 2_-44_2_-38 2_-7_2_-1 2_32_2_34 \
     --soloUMIposition 0_0_0_9 \
     --soloCBwhitelist paired-seq/data/round234_bc.txt paired-seq/data/round234_bc.txt paired-seq/data/round234_bc.txt paired-seq/data/round1_bc.txt \
     --soloCBmatchWLtype 1MM \
     --soloCellFilter EmptyDrops_CR \
     --outSAMattributes CB UB \
     --outSAMtype BAM SortedByCoordinate 

# process the ATAC library using chromap

## map and generate the fragment file

chromap -t 4 --preset atac \
        -x mm10/chromap_index/genome.index \
        -r mm10/mm10.fa \
        -1 paired-seq/data/SRR8980190_extracted_R1.fastq.gz \
        -b paired-seq/data/SRR8980190_extracted_CB.fastq.gz \
        --barcode-whitelist paired-seq/data/whitelist.txt \
        -o paired-seq/chromap_outs/fragments.tsv

## compress and index the fragment file

bgzip paired-seq/chromap_outs/fragments.tsv
tabix -s 1 -b 2 -e 3 -p bed paired-seq/chromap_outs/fragments.tsv.gz
```

After this stage, we are done with the RNA library. The count matrix and other useful information can be found in the `star_outs` directory. For the ATAC library, two new files `fragments.tsv.gz` and `fragments.tsv.gz.tbi` are generated. They will be useful and sometimes required for other programs to perform downstream analysis. There are still some extra work.

### Explain star and chromap

If you understand the __Paired-seq__ experimental procedures described in [this GitHub Page](https://teichlab.github.io/scg_lib_structs/methods_html/Paired-seq.html) and read the manual of the programs, the commands above should be straightforward to understand.

#### Explain star

`--runThreadN 4`
  
>> Use 4 cores for the preprocessing. Change accordingly if using more or less cores.

`--genomeDir mm10/star_index`

>> Pointing to the directory of the star index. The public data we are analysing is from the cerebral cortex of an adult mouse.

`--readFilesCommand zcat`

>> Since the `fastq` files are in `.gz` format, we need the `zcat` command to extract them on the fly.

`--outFileNamePrefix paired-seq/star_outs/`

>> We want to keep everything organised. This directs all output files inside the `paired-seq/star_outs` directory.

`--readFilesIn`

>> If you check the manual, we should put two files here. The first file is the reads that come from cDNA, and the second the file should contain cell barcode and UMI. In __Paired-seq__, cDNA reads come from Read 1. The cell barcode and UMI, together with three linker sequences, come from Read 2. Check [the Paired-seq GitHub Page](https://teichlab.github.io/scg_lib_structs/methods_html/Paired-seq.html) if you are not sure. Multiple input files are supported and they can be listed in a comma-separated manner. In that case, they must be in the same order.

`--soloType CB_UMI_Complex`

>> Since Read 2 not only has cell barcodes and UMI, the common linker sequences are also there. The cell barcodes are non-consecutive, separated by the linker sequences. In this case, we have to use the `CB_UMI_Complex` option. Of course, we could also use `UMI-tools` to extract the cell barcode and UMI like the ATAC modality, but that's slow. It is better to use this option. See below.

`--soloAdapterSequence ATCCACGTGCTTGAGAGGCCAGAGCATTCGTC`

>> The 0 - 3 random bases in the middle of __Read 2__ makes the situation complicated, because the absolute positions of the cell barcode and UMI in each read will vary. However, by specifying an adapter sequence, we could use this sequence as an anchor, and tell the program where cell barcodes and UMI are located relatively to the anchor. I choose this linker sequence as the adaptor because it is the longest. However, the other two linker sequences can be used as well. See below.

`--soloAdapterMismatchesNmax 3`

>> The number of mismatches are tolerated during the adapter finding. The adapter here is a bit long, so I want a bit relaxed matching, but you may want to try a few different options, like 1 (the default) or 2.

`--soloCBposition` and `--soloUMIposition`

>> These options specify the locations of cell barcode and UMI in the 2nd fastq files we passed to `--readFilesIn`. In this case, it is __Read 2__. Read the [STAR manual](https://github.com/alexdobin/STAR/blob/master/doc/STARmanual.pdf) for more details. I have drawn a picture to help myself decide the exact parameters. There are some freedom here depending on what you are using as anchors. Due to the 3 random bases in the middle, using Read start as anchor will not work for the barcodes in the middle. We need to use the adapter as the anchor, and specify the positions relative to the anchor. See the image:

![](https://teichlab.github.io/scg_lib_structs/data/Paired-seq/Star_CB_UMI_Complex_Paired-seq.jpg)

`--soloCBwhitelist`

>> Since the real cell barcodes consists of four non-consecutive parts, the whitelist here is the combination of the four sub-lists. We should provide them separately and `star` will take care of the combinations.

`--soloCBmatchWLtype 1MM`

>> How stringent we want the cell barcode reads to match the whitelist. The default option (`1MM_Multi`) does not work here. We choose this one here for simplicity, but you might want to experimenting different parameters to see what the difference is.

`--soloCellFilter EmptyDrops_CR`

>> Experiments are never perfect. Even for barcodes that do not capture the molecules inside the cells, you may still get some reads due to various reasons, such as ambient RNA or DNA and leakage. In general, the number of reads from those cell barcodes should be much smaller, often orders of magnitude smaller, than those barcodes that come from real cells. In order to identify true cells from the background, you can apply different algorithms. Check the `star` manual for more information. We use `EmptyDrops_CR` which is the most frequently used parameter.

`--soloStrand Forward`

>> The choice of this parameter depends on where the cDNA reads come from, i.e. the reads from the first file passed to `--readFilesIn`. You need to check the experimental protocol. If the cDNA reads are from the same strand as the mRNA (the coding strand), this parameter will be `Forward` (this is the default). If they are from the opposite strand as the mRNA, which is often called the first strand, this parameter will be `Reverse`. In the case of __Paired-seq__, the cDNA reads are from the Read 1 file. During the experiment, the mRNA molecules are captured by barcoded oligo-dT primer containing UMI and the Read 2 sequence. Therefore, Read 2 consists of cell barcodes and UMI come from the first strand, complementary to the coding strand. Read 1 comes from the coding strand. Therefore, use `Forward` for __Paired-seq__ data. This `Forward` parameter is the default, because many protocols generate data like this, but I still specified it here to make it clear. Check [the Paired-seq GitHub Page](https://teichlab.github.io/scg_lib_structs/methods_html/Paired-seq.html) if you are not sure.

`--outSAMattributes CB UB`

>> We want the cell barcode and UMI sequences in the `CB` and `UB` attributes of the output, respectively. The information will be very helpful for downstream analysis. 

`--outSAMtype BAM SortedByCoordinate`

>> We want sorted `BAM` for easy handling by other programs.

#### Explain chromap

`-t 4`

>> Use 4 cores for the preprocessing. Change accordingly if using more or less cores.

`-x mm10/chromap_index/genome.index`

>> The `chromap` index file. The public data we are analysing is from the cerebral cortex of an adult mouse.

`-r mm10/mm10.fa`

>> Reference genome sequence in `fasta` format. This is basically the file which you used to create the `chromap` index file.

`-1`, and `-b`

>> They are Read 1 (genomic) and cell barcode read, respectively. For ATAC-seq, the sequencing is usually done in pair-end mode. However, the Read 2 in __Paired-seq__ only contains cell barcodes and UMI. Therefore, the ATAC-seq is essentially single-end. `R1` is the genomic Read 1 and should be passed to `-1`; The `CB` file we just prepared contains the cell barcode and should be passed to `-b`. Multiple input files are supported and they can be listed in a comma-separated manner. In that case, they must be in the same order.

`--barcode-whitelist paired-seq/data/whitelist.txt`

>> The plain text file containing all possible valid cell barcodes, one per line. This is the whitelist we just prepared in the previous section. It contains all possible combination of the 96 8-bp barcodes for three times. A total of 96 * 96 * 96 * 8 = 7,077,888 barcodes are in this file.

`-o paired-seq/chromap_outs/fragments.tsv`

>> Direct the mapped fragments to a file. The format is described in the [10x Genomics website](https://support.10xgenomics.com/single-cell-atac/software/pipelines/latest/output/fragments).

```{eval-rst}
.. important::

  For single-end ATAC-seq, I'm not sure how to interpret the ``fragment.tsv`` file, because there is no fragments, just reads in the single-end data. Based on the content and length inside the file, it seems it contains the reads. For the sake of demonstration, I just treat this file as the real fragment file, as if it is from pair-end data.

```

### From ATAC Fragments To Reads

The fragment file is the following format:

| Column number | Meaning                               |
|---------------|---------------------------------------|
| 1             | fragment chromosome                   |
| 2             | fragment start                        |
| 3             | fragment end                          |
| 4             | cell barcode                          |
| 5             | Number of read pairs of this fragment |

It is very useful, but we often need the peak-by-cell matrix for the downstream analysis. Therefore, we need to perform a peak calling process to identify open chromatin regions. We need to convert the fragment into reads. For each fragment, we will have two reads, a forward read and a reverse read. The read length is not important, but we could generate a 50-bp read pair for each fragment.

First, we need to create a genome size file, which is a tab delimited file with only two columns. The first column is the chromosome name and the second column is the length of the chromosome in bp:

```console
# we also sort the output by chromosome name
# which will be useful later

faSize -detailed mm10/genome.fa | \
    sort -k1,1 > mm10/mm10.chrom.sizes
```

This is the first 5 lines of `mm10/mm10.chrom.sizes`:

```
chr1	195471971
chr10	130694993
chr11	122082543
chr12	120129022
chr13	120421639
```

Now let's generate the reads from fragments:

```bash
# we use bedClip to remove reads outside the chromosome boundary
# we also remove reads mapped to the mitochondrial genome (chrM)

zcat paired-seq/chromap_outs/fragments.tsv.gz | \
    awk 'BEGIN{OFS="\t"}{print $1, $2, $2+50, $4, ".", "+" "\n" $1, $3-50, $3, $4, ".", "-"}' | \
    sed '/chrM/d' | \
    bedClip stdin mm10/mm10.chrom.sizes stdout | \
    sort -k1,1 -k2,2n | \
    gzip > paired-seq/chromap_outs/reads.bed.gz
```

Note we also sort the output reads by `sort -k1,1 -k2,2n`. In this way, the order of chromosomes in the `reads.bed.gz` is the same as that in `genome.chrom.sizes`, which makes downstream processes easier. The output `reads.bed.gz` are the reads in `bed` format, with the 4th column holding the cell barcodes.

### Peak Calling By MACS2

Now we can use the newly generated read file for the peak calling using `MACS2`:

```console
macs2 callpeak -t paired-seq/chromap_outs/reads.bed.gz \
               -g mm -f BED -q 0.01 \
               --nomodel --shift -100 --extsize 200 \
               --keep-dup all \
               -B --SPMR \
               --outdir paired-seq/chromap_outs \
               -n aggregate
```

#### Explain MACS2

The reasons of choosing those specific parameters are a bit more complicated. I have dedicated a post for this a while ago. Please have a look at [__this post__](https://dbrg77.github.io/posts/2020-12-09-atac-seq-peak-calling-with-macs2/) if you are still confused. Note the `-g`, which is the genome size parameter, is basically the sum of human and mouse. The following output files are particularly useful:

| File                       | Description                                                               |
|----------------------------|---------------------------------------------------------------------------|
| aggregate_peaks.narrowPeak | Open chromatin peak locations in the narrowPeak format                    |
| aggregate_peaks.xls        | More information about peaks                                              |
| aggregate_treat_pileup.bdg | Signal tracks. Can be used to generate the bigWig file for visualisation |

### Getting The Peak-By-Cell Count Matrix

Now that we have the peak and reads files, we can compute the number of reads in each peak for each cell. Then we could get the peak-by-cell count matrix. There are different ways of doing this. The following is the method I use.

#### Find Reads In Peaks Per Cell

First, we use the `aggregate_peaks.narrowPeak` file. We only need the first 4 columns (chromosome, start, end, peak ID). You can also remove the peaks that overlap [the black list regions](https://www.nature.com/articles/s41598-019-45839-z). The black list is not available for every species and every build, so I'm not doing it here. We also need to sort the peak to make sure the order of the chromosomes in the peak file is the same as that in the `genome.chrom.sizes` and `reads.bed.gz` files. Then we could find the overlap by `bedtools`. We need to do this in a specific way to get the number of reads in each peak from each cell:

```bash
# format and sort peaks

cut -f 1-4 paired-seq/chromap_outs/aggregate_peaks.narrowPeak | \
    sort -k1,1 -k2,2n > paired-seq/chromap_outs/aggregate_peaks_sorted.bed

# prepare the overlap

bedtools intersect \
    -a paired-seq/chromap_outs/aggregate_peaks_sorted.bed \
    -b paired-seq/chromap_outs/reads.bed.gz \
    -wo -sorted -g mm10/mm10.chrom.sizes | \
    sort -k8,8 | \
    bedtools groupby -g 8 -c 4 -o freqdesc | \
    gzip > paired-seq/chromap_outs/peak_read_ov.tsv.gz
```

##### Explain Finding Reads In Peaks Per Cell

We start with the command before the first pipe, that is, the intersection part. If you read the manual of the `bedtools intersect`, it should be straightforward to understand. The `-wo` option will output the records in both `-a` file and `-b` file. Since the `reads.bed.gz` file has the cell barcode information at the 4th column, we would get an output with both peak and cell information for the overlap. The `-sorted -g mm10/mm10.chrom.sizes` options make the program use very little memory. Here is an example (top 5 lines) of the output of this part:

```console
chr1	3120021	3120278	aggregate_peak_1	chr1	3120049	3120099	TAGTCACAGCTATTGTAATCGTCT	.	+	50
chr1	3120021	3120278	aggregate_peak_1	chr1	3120052	3120102	TAGTCACAGCTATTGTAATCGTCT	.	-	50
chr1	3120021	3120278	aggregate_peak_1	chr1	3120062	3120112	GTGGTCTAGAAAGGGGAAGAATGA	.	-	50
chr1	3120021	3120278	aggregate_peak_1	chr1	3120063	3120113	ACGATTGATAAGGGAAGAAGCTGA	.	+	50
chr1	3120021	3120278	aggregate_peak_1	chr1	3120064	3120114	GTGGTCTAGAAAGGGGAAGAATGA	.	+	50
```

We see that the 8th column holds the cell barcode and we want to group them using `bedtools groupby`. Therefore, we need to sort by this column, that is the `sort -k8,8`. When we group by the 8th column, we are interested in how many times each peak appear per group, so we could gather the information of the peak ID (4th column). That is the `-g 8 -c 4 -o freqdesc`. The `-o freqdesc` option returns a `value:frequency` pair in descending order. Here are some records from `peak_read_ov.tsv.gz`:

```console
AAACCGGAAACCGGAGCTATTTGA	aggregate_peak_19496:6
AAACCGGAAACCGGATAAGGGTGA	aggregate_peak_30191:2
AAACCGGAAACCGGCAGAGTGCTC	aggregate_peak_65730:12
```

In a way, that is sort of a count matrix in an awkward format. For example:

- The first line means that in cell `AAACCGGAAACCGGAGCTATTTGA`, the peak `aggregate_peak_19496` has 6 counts. All the rest peaks not mentioned here have 0 counts in this cell.
- The second line means that in cell `AAACCGGAAACCGGATAAGGGTGA`, the peak `aggregate_peak_30191` has 2 counts. All the rest peaks not mentioned here have 0 counts in this cell.

#### Output The Peak-By-Cell Matrix

At this stage, we pretty much have all the things needed. Those two files `aggregate_peaks_sorted.bed` and `peak_read_ov.tsv.gz` contain all information for a peak-by-cell count matrix. We just need a final touch to make the output in a standard format: a [market exchange format (MEX)](https://math.nist.gov/MatrixMarket/formats.html). Since most downstream software takes the input from the __10x Genomics Single Cell ATAC__ results, we are going to generate the MEX and the associated files similar to the output from 10x Genomics.

Here, I'm using a python script for this purpose. You don't have to do this. Choose whatever works for you. The point here is to just generate similar files as the __peak-barcode matrix__ described from [the 10x Genomics website](https://support.10xgenomics.com/single-cell-atac/software/pipelines/latest/output/matrices).

First, let's make a directory to hold the output files and generate the `peaks.bed` and `barcodes.tsv` files, which are easy to do:

```bash
# create dirctory
mkdir -p paired-seq/chromap_outs/raw_peak_bc_matrix

# The 10x Genomics peaks.bed is a 3-column bed file, so we do
cut -f 1-3 paired-seq/chromap_outs/aggregate_peaks_sorted.bed > \
    paired-seq/chromap_outs/raw_peak_bc_matrix/peaks.bed

# The barcode is basically the first column of the file peak_read_ov.tsv.gz
zcat paired-seq/chromap_outs/peak_read_ov.tsv.gz | \
    cut -f 1 > \
    paired-seq/chromap_outs/raw_peak_bc_matrix/barcodes.tsv
```

The slightly more difficult file to generate is `matrix.mtx`. This is the python script `generate_csc_mtx.py` for this purpose:

```python
# import helper packages
# most entries in the count matrix is 0, so we are going to use a sparse matrix
# since we need to keep updating the sparse matrix, we use lil_matrix from scipy
import sys
import gzip
from scipy.io import mmwrite
from scipy.sparse import lil_matrix

# the unique peak ID is a good renference
# generate a dictionary with peak_id : index_in_the_file
# sys.argv[1] is the 4-column bed file aggregate_peaks_sorted.bed
peak_idx = {}
with open(sys.argv[1]) as fh:
    for i, line in enumerate(fh):
        _, _, _, peak_name = line.strip().split('\t')
        peak_idx[peak_name] = i

# determine and create the dimension of the output matrix
# that is, to calculate the number of peaks and the number of barcodes
# sys.argv[2] is barcodes.tsv
num_peaks = len(peak_idx.keys())
num_cells = len(open(sys.argv[2]).readlines())
mtx = lil_matrix((num_peaks, num_cells), dtype = int)

# read the information from peak_read_ov.tsv.gz
# update the counts into the mtx object
# sys.argv[3] is peak_read_ov.tsv.gz
with gzip.open(sys.argv[3], 'rt') as fh:
    for i, line in enumerate(fh):
        col_idx = i # each column is a cell barcode
        count_info = line.strip().split('\t')[1]
        items = count_info.split(',')
        for pn_count in items:
            pn, count = pn_count.split(':')
            row_idx = peak_idx[pn] # each row is a peak
            mtx[row_idx, col_idx] = int(count)

# get a CSC sparse matrix, which is the same as the 10x Genomics matrix.mtx
mtx = mtx.tocsc()

# sys.argv[4] is the path to the output directory
mmwrite(sys.argv[4] + '/matrix.mtx', mtx, field='integer')
```

Run that script in the terminal:

```bash
python generate_csc_mtx.py \
    paired-seq/chromap_outs/aggregate_peaks_sorted.bed \
    paired-seq/chromap_outs/raw_peak_bc_matrix/barcodes.tsv \
    paired-seq/chromap_outs/peak_read_ov.tsv.gz \
    paired-seq/chromap_outs/raw_peak_bc_matrix
```

After that, you should have the `matrix.mtx` in the `paired-seq/chromap_outs/raw_peak_bc_matrix` directory.

#### Cell Calling (Filter Cell Barcodes)

Experiments are never perfect. Even for droplets that do not contain any cell, you may still get some reads. In general, the number of reads from those droplets should be much smaller, often orders of magnitude smaller, than those droplets with cells. In order to identify true cells from the background, we could use `starolo`. It is used for scRNA-seq in general, but it does have a cell calling function that takes a directory containing raw `mtx` and associated files, and return the filtered ones. Since `starsolo` looks for the following three files in the input directory: `matrix.mtx`, `features.tsv` and `barcodes.tsv`. Those are the output from the 10x Genomics scRNA-seq workflow. In this case, we can use `peaks.bed` as our `features.tsv`:

```console
# trick starsolo to use peaks.bed as features.tsv by creating symlink

ln -s peaks.bed paired-seq/chromap_outs/raw_peak_bc_matrix/features.tsv

# filter cells using starsolo

STAR --runMode soloCellFiltering \
     paired-seq/chromap_outs/raw_peak_bc_matrix \
     paired-seq/chromap_outs/filtered_peak_bc_matrix/ \
     --soloCellFilter EmptyDrops_CR

# rename the new feature.tsv to peaks.bed or just create symlink
ln -s features.tsv paired-seq/chromap_outs/filtered_peak_bc_matrix/peaks.bed
```

If everything goes well, your directory should look the same as the following:

```console
scg_prep_test/paired-seq/
├── chromap_outs
│   ├── aggregate_control_lambda.bdg
│   ├── aggregate_peaks.narrowPeak
│   ├── aggregate_peaks_sorted.bed
│   ├── aggregate_peaks.xls
│   ├── aggregate_summits.bed
│   ├── aggregate_treat_pileup.bdg
│   ├── filtered_peak_bc_matrix
│   │   ├── barcodes.tsv
│   │   ├── features.tsv
│   │   ├── matrix.mtx
│   │   └── peaks.bed -> features.tsv
│   ├── fragments.tsv.gz
│   ├── peak_read_ov.tsv.gz
│   ├── raw_peak_bc_matrix
│   │   ├── barcodes.tsv
│   │   ├── features.tsv -> peaks.bed
│   │   ├── matrix.mtx
│   │   └── peaks.bed
│   └── reads.bed.gz
├── data
│   ├── paired-seq_bc01.csv
│   ├── paired-seq_bc02-03-04.csv
│   ├── round1_bc.txt
│   ├── round234_bc.txt
│   ├── SRR8980190_1.fastq.gz
│   ├── SRR8980190_2.fastq.gz
│   ├── SRR8980190_cleaned_R1.fastq.gz
│   ├── SRR8980190_cleaned_R2.fastq.gz
│   ├── SRR8980190_extracted_CB.fastq.gz
│   ├── SRR8980190_extracted_R1.fastq.gz
│   ├── SRR8980191_1.fastq.gz
│   ├── SRR8980191_2.fastq.gz
│   ├── SRR8980191_cleaned_R1.fastq.gz
│   ├── SRR8980191_cleaned_R2.fastq.gz
│   └── whitelist.txt
└── star_outs
    ├── Aligned.sortedByCoord.out.bam
    ├── Log.final.out
    ├── Log.out
    ├── Log.progress.out
    ├── SJ.out.tab
    └── Solo.out
        ├── Barcodes.stats
        └── Gene
            ├── Features.stats
            ├── filtered
            │   ├── barcodes.tsv
            │   ├── features.tsv
            │   └── matrix.mtx
            ├── raw
            │   ├── barcodes.tsv
            │   ├── features.tsv
            │   └── matrix.mtx
            ├── Summary.csv
            └── UMIperCellSorted.txt

9 directories, 47 files
```